Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circ-SMAD7 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Esophageal Squamous Cell Carcinoma (ESCC) | ICD-10 | Oesophagus, unspecified (C15.9) |
DBLink | Link to database | PMID | 30611100 |
Experimental Method | |||
Sample Type | Blood and Tissue samples | Comparison | Peripheral blood (5"‰ml) of 32 ESCC patients and 6 paired ESCC tissues and adjacent noncancerous tissues |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GGGGAGTGGCTGTGGATAA ReverseTCTCAAGAGGGATTTACAAACG | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Zhang, Y, Wang, Q, Zhu, D, Rong, J, Shi, W, Cao, X (2019). Up-regulation of circ-SMAD7 inhibits tumor proliferation and migration in esophageal squamous cell carcinoma. Biomed. Pharmacother., 111:596-601. |